| |  | Cat. No. 69103 | |
|
| Convenient sequencing and amplification of recombinant vectors | | | | All vector primers have been application-tested and are supplied ready to use at the working concentration (5 pmol/µl). Each vial contains a total of 500 pmol (100 µl) of oligonucleotide. | | | | | |
IE1 Promoter Primer, Mr: 6774 Sequence: TGGATATTGTTTCAGTTGCAAG | |
| Need additional information about this product? Email our Technical Service department at: novatech@novagen.com |
| Related information for this product is available: | |
| |
EMD Chemicals Inc. list price is displayed (pricing with local distributors may vary). NOTE: In Stock status is based on item availability worldwide.
EMD Chemicals Inc. list price is displayed (pricing with local distributors may vary). NOTE: In Stock status is based on item availability worldwide.
| IE1 Terminator Primer | 71247-3 | 500 pmol | * | N/A | |
* Additional Product Information
|